ID: 1139496444_1139496446

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1139496444 1139496446
Species Human (GRCh38) Human (GRCh38)
Location 16:67322995-67323017 16:67323009-67323031
Sequence CCCACAACAGAATACTACTTCAC CTACTTCACACCCATTAGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 171} {0: 1, 1: 17, 2: 159, 3: 729, 4: 1874}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!