ID: 1139498472_1139498482

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1139498472 1139498482
Species Human (GRCh38) Human (GRCh38)
Location 16:67339787-67339809 16:67339838-67339860
Sequence CCCACTAATTTCTCCGTGGTATG TATGACTATTTAAAGCTTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75} {0: 1, 1: 0, 2: 1, 3: 10, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!