ID: 1139513222_1139513232

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1139513222 1139513232
Species Human (GRCh38) Human (GRCh38)
Location 16:67439016-67439038 16:67439052-67439074
Sequence CCGAGCCAGCTGCGCCAGGCCCT CCCACAGTGTGGAAAGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 288} {0: 1, 1: 0, 2: 2, 3: 32, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!