ID: 1139529876_1139529889

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1139529876 1139529889
Species Human (GRCh38) Human (GRCh38)
Location 16:67537815-67537837 16:67537842-67537864
Sequence CCAGCTCTGGGAATCCCCCTGCC GGGCGCCGGGACGCCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 436} {0: 1, 1: 0, 2: 4, 3: 43, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!