ID: 1139529919_1139529931

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139529919 1139529931
Species Human (GRCh38) Human (GRCh38)
Location 16:67537922-67537944 16:67537970-67537992
Sequence CCGGCTGGGCCTGTCGGGCAGCT CCCCGCCCCGTGACCTCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 206} {0: 1, 1: 0, 2: 1, 3: 14, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!