ID: 1139531341_1139531346

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1139531341 1139531346
Species Human (GRCh38) Human (GRCh38)
Location 16:67544139-67544161 16:67544168-67544190
Sequence CCTTCCTCCTTCTGGAAATCCTC CTTACCCCACTGTCTGCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 50, 4: 431} {0: 1, 1: 0, 2: 1, 3: 13, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!