ID: 1139581785_1139581790

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1139581785 1139581790
Species Human (GRCh38) Human (GRCh38)
Location 16:67878168-67878190 16:67878186-67878208
Sequence CCTCAGTGAAGGAGCCCTCTCTC CTCTCCTGATGGGACTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179} {0: 1, 1: 0, 2: 1, 3: 18, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!