ID: 1139581857_1139581861

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1139581857 1139581861
Species Human (GRCh38) Human (GRCh38)
Location 16:67878506-67878528 16:67878529-67878551
Sequence CCAGTCACTCACTGCCTTGTTGC CTTGCAGTGTCCCTTTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195} {0: 1, 1: 0, 2: 1, 3: 21, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!