ID: 1139581857_1139581864

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1139581857 1139581864
Species Human (GRCh38) Human (GRCh38)
Location 16:67878506-67878528 16:67878543-67878565
Sequence CCAGTCACTCACTGCCTTGTTGC TTCTGGAGGTTCCTTATTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195} {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!