ID: 1139582319_1139582328

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1139582319 1139582328
Species Human (GRCh38) Human (GRCh38)
Location 16:67880832-67880854 16:67880874-67880896
Sequence CCAGCTCGGGCTTGATGGAGGCC TAATACCCCCTCCCTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103} {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!