ID: 1139584516_1139584521

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1139584516 1139584521
Species Human (GRCh38) Human (GRCh38)
Location 16:67893336-67893358 16:67893355-67893377
Sequence CCGCCGAGACGCCGAAGAGCCCG CCCGCCGCCCGCGCGAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 32} {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!