ID: 1139589992_1139589996

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1139589992 1139589996
Species Human (GRCh38) Human (GRCh38)
Location 16:67928229-67928251 16:67928244-67928266
Sequence CCTTCATGGTGCCTCCAGGGAGC CAGGGAGCCTTCCTGGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 16, 4: 250} {0: 1, 1: 0, 2: 6, 3: 27, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!