ID: 1139589992_1139590007

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1139589992 1139590007
Species Human (GRCh38) Human (GRCh38)
Location 16:67928229-67928251 16:67928270-67928292
Sequence CCTTCATGGTGCCTCCAGGGAGC TCTGGTGGAGGGCCATGGCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 16, 4: 250} {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!