ID: 1139592240_1139592244

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1139592240 1139592244
Species Human (GRCh38) Human (GRCh38)
Location 16:67939776-67939798 16:67939799-67939821
Sequence CCATCTTGCCTCACTGCACACAG CACTGAGCCTGTGGCTGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 651} {0: 1, 1: 0, 2: 3, 3: 40, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!