ID: 1139596389_1139596395

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1139596389 1139596395
Species Human (GRCh38) Human (GRCh38)
Location 16:67960731-67960753 16:67960782-67960804
Sequence CCTCAGCTACACTGAGCCGCAAT CAGTCACCCCAAAGAGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105} {0: 1, 1: 0, 2: 0, 3: 15, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!