ID: 1139603747_1139603757

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1139603747 1139603757
Species Human (GRCh38) Human (GRCh38)
Location 16:68003034-68003056 16:68003083-68003105
Sequence CCATCTTCCCCGTGATTTCCGTG AACTCAGGGGTGCTGAACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 117} {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!