ID: 1139604646_1139604651

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1139604646 1139604651
Species Human (GRCh38) Human (GRCh38)
Location 16:68009470-68009492 16:68009492-68009514
Sequence CCCAGCACCAGCTGTCCCAGCTG GCAGAGAGAGACAGTCCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 450} {0: 1, 1: 0, 2: 2, 3: 29, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!