ID: 1139606633_1139606640

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1139606633 1139606640
Species Human (GRCh38) Human (GRCh38)
Location 16:68023383-68023405 16:68023397-68023419
Sequence CCAGACCCGGCCAGCCTTGGGGA CCTTGGGGAAGGGCGCGTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 258} {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!