ID: 1139619253_1139619261

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1139619253 1139619261
Species Human (GRCh38) Human (GRCh38)
Location 16:68123859-68123881 16:68123889-68123911
Sequence CCTATAGTCCCAGGTACTAGGGA GCGGGAGCATTGCCTGAGATGGG
Strand - +
Off-target summary {0: 3, 1: 524, 2: 12994, 3: 137789, 4: 259476} {0: 1, 1: 0, 2: 7, 3: 195, 4: 2596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!