ID: 1139619588_1139619589

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1139619588 1139619589
Species Human (GRCh38) Human (GRCh38)
Location 16:68126884-68126906 16:68126912-68126934
Sequence CCGTATTATATTTATGAATAAAA GCTCATTTAAAATTTAATACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 96, 4: 1186} {0: 1, 1: 0, 2: 1, 3: 27, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!