ID: 1139630177_1139630188

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1139630177 1139630188
Species Human (GRCh38) Human (GRCh38)
Location 16:68226541-68226563 16:68226573-68226595
Sequence CCAACTCTGCAGCCTTCAGGTCT AGTGGGACCCACCATTTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 297} {0: 1, 1: 0, 2: 0, 3: 4, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!