ID: 1139632264_1139632276

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1139632264 1139632276
Species Human (GRCh38) Human (GRCh38)
Location 16:68237766-68237788 16:68237785-68237807
Sequence CCTCCCCCTCCCGCCCGGTAGGG AGGGCGCCTGCGCTTGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 102, 4: 5829} {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!