ID: 1139657137_1139657143

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1139657137 1139657143
Species Human (GRCh38) Human (GRCh38)
Location 16:68395949-68395971 16:68395967-68395989
Sequence CCTGTCCCAGGGGTGCCTCAACT CAACTCAGTGTGCCTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126} {0: 1, 1: 0, 2: 2, 3: 27, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!