ID: 1139657352_1139657361

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1139657352 1139657361
Species Human (GRCh38) Human (GRCh38)
Location 16:68397143-68397165 16:68397184-68397206
Sequence CCATCCTGGTTAGCATTTTGACC ACAGGAGGCACCCATAGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 136} {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!