ID: 1139751915_1139751920

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1139751915 1139751920
Species Human (GRCh38) Human (GRCh38)
Location 16:69114100-69114122 16:69114140-69114162
Sequence CCACTTAGTGGGGAAAATCTCTG TAGGGAGGTAGAGCTGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136} {0: 1, 1: 1, 2: 0, 3: 23, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!