ID: 1139752960_1139752966

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1139752960 1139752966
Species Human (GRCh38) Human (GRCh38)
Location 16:69120262-69120284 16:69120284-69120306
Sequence CCGGCCGCCATAAGGAAGGGATC CCGAGTTCACACCCAGTGGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 57} {0: 2, 1: 0, 2: 0, 3: 5, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!