ID: 1139752961_1139752964

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1139752961 1139752964
Species Human (GRCh38) Human (GRCh38)
Location 16:69120266-69120288 16:69120281-69120303
Sequence CCGCCATAAGGAAGGGATCCGAG GATCCGAGTTCACACCCAGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 68} {0: 2, 1: 0, 2: 3, 3: 32, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!