ID: 1139752974_1139752988

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139752974 1139752988
Species Human (GRCh38) Human (GRCh38)
Location 16:69120325-69120347 16:69120373-69120395
Sequence CCCCCCTGTGGTCCCAGGGAACC GGAGCACGAGTCCAAGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 319} {0: 1, 1: 1, 2: 0, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!