ID: 1139752986_1139752991

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1139752986 1139752991
Species Human (GRCh38) Human (GRCh38)
Location 16:69120358-69120380 16:69120386-69120408
Sequence CCTCGAGGTGGCAGCGGAGCACG AAGGAGTTGGCCGCTCTCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 105} {0: 2, 1: 0, 2: 0, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!