ID: 1139765337_1139765342

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1139765337 1139765342
Species Human (GRCh38) Human (GRCh38)
Location 16:69223918-69223940 16:69223965-69223987
Sequence CCACACCCGGCCGACAGTTCTTC TTGACACTTTAGAAGAATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 119, 4: 728} {0: 1, 1: 2, 2: 72, 3: 253, 4: 726}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!