ID: 1139805939_1139805948

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1139805939 1139805948
Species Human (GRCh38) Human (GRCh38)
Location 16:69565780-69565802 16:69565805-69565827
Sequence CCCTGGCAGCGGGGCCCTTTCCC CTCAGGAACAGCAGCAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 156} {0: 1, 1: 0, 2: 3, 3: 69, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!