ID: 1139823784_1139823789

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1139823784 1139823789
Species Human (GRCh38) Human (GRCh38)
Location 16:69741025-69741047 16:69741077-69741099
Sequence CCTGGGCGACAGAGCAAGACTCC AAAAAAAGCACAGATGGGGCTGG
Strand - +
Off-target summary {0: 9543, 1: 56297, 2: 100900, 3: 135875, 4: 143165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!