|
Left Crispr |
Right Crispr |
Crispr ID |
1139823784 |
1139823790 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:69741025-69741047
|
16:69741078-69741100
|
Sequence |
CCTGGGCGACAGAGCAAGACTCC |
AAAAAAGCACAGATGGGGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 9543, 1: 56297, 2: 100900, 3: 135875, 4: 143165} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|