ID: 1139823785_1139823789

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1139823785 1139823789
Species Human (GRCh38) Human (GRCh38)
Location 16:69741046-69741068 16:69741077-69741099
Sequence CCGTCTCAAAAAAAAAAAAAAAA AAAAAAAGCACAGATGGGGCTGG
Strand - +
Off-target summary {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091} {0: 1, 1: 0, 2: 12, 3: 138, 4: 1049}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!