|
Left Crispr |
Right Crispr |
Crispr ID |
1139823785 |
1139823789 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:69741046-69741068
|
16:69741077-69741099
|
Sequence |
CCGTCTCAAAAAAAAAAAAAAAA |
AAAAAAAGCACAGATGGGGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|