ID: 1139850744_1139850755

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1139850744 1139850755
Species Human (GRCh38) Human (GRCh38)
Location 16:69950630-69950652 16:69950644-69950666
Sequence CCCCCTGGCCTGTAGTCACGTGG GTCACGTGGGTGAGGGTGGTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 9, 4: 105} {0: 2, 1: 1, 2: 3, 3: 28, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!