ID: 1139874869_1139874871

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1139874869 1139874871
Species Human (GRCh38) Human (GRCh38)
Location 16:70137658-70137680 16:70137697-70137719
Sequence CCACGATGAAAAGTTTATTTTAA CTCTTGAGTGATTTGTAGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 427} {0: 2, 1: 0, 2: 0, 3: 20, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!