ID: 1139891827_1139891837

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1139891827 1139891837
Species Human (GRCh38) Human (GRCh38)
Location 16:70258075-70258097 16:70258111-70258133
Sequence CCAGAGGGGTCATCCAGCAACTC CCAATGGAGACGACTCGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 100} {0: 1, 1: 0, 2: 0, 3: 3, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!