ID: 1139891833_1139891840

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1139891833 1139891840
Species Human (GRCh38) Human (GRCh38)
Location 16:70258103-70258125 16:70258122-70258144
Sequence CCGGGACCCCAATGGAGACGACT GACTCGCACAGGGTCAGGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44} {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!