ID: 1139911629_1139911638

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1139911629 1139911638
Species Human (GRCh38) Human (GRCh38)
Location 16:70400844-70400866 16:70400886-70400908
Sequence CCCACAGGCCTCATCAGGGCTCC CCCCAGCAGCACTGGCTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 198} {0: 1, 1: 0, 2: 2, 3: 33, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!