ID: 1139915347_1139915356

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1139915347 1139915356
Species Human (GRCh38) Human (GRCh38)
Location 16:70424884-70424906 16:70424931-70424953
Sequence CCTGCTGGAGTCCTGGGTTCACT CTGGACCAGGCACTGTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 221} {0: 1, 1: 1, 2: 14, 3: 65, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!