ID: 1139945122_1139945125

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1139945122 1139945125
Species Human (GRCh38) Human (GRCh38)
Location 16:70635557-70635579 16:70635590-70635612
Sequence CCTTCAGCAGAACATCGGCAGCT GGAGCTGTTTCCAGTGTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 81} {0: 1, 1: 0, 2: 2, 3: 17, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!