ID: 1139950317_1139950330

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1139950317 1139950330
Species Human (GRCh38) Human (GRCh38)
Location 16:70665150-70665172 16:70665187-70665209
Sequence CCGGGGGCCCGTCACTGTGGCTG CAGGGCTATCAGGGGGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 458} {0: 1, 1: 0, 2: 1, 3: 15, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!