ID: 1139956971_1139956977

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139956971 1139956977
Species Human (GRCh38) Human (GRCh38)
Location 16:70697786-70697808 16:70697834-70697856
Sequence CCACAGGAGGGAGGCAGGGCTGT GCCCCAGATGCCCCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 65, 4: 527} {0: 1, 1: 0, 2: 2, 3: 48, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!