ID: 1139958674_1139958676

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1139958674 1139958676
Species Human (GRCh38) Human (GRCh38)
Location 16:70705399-70705421 16:70705412-70705434
Sequence CCTCTCTGCGCAGGTGGGCCAAC GTGGGCCAACCTGGCGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83} {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!