ID: 1139981881_1139981888

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1139981881 1139981888
Species Human (GRCh38) Human (GRCh38)
Location 16:70865811-70865833 16:70865837-70865859
Sequence CCTATACCCACCAGTGTGGATAT CTGGGTTACCACTTGGTGCATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 79} {0: 2, 1: 0, 2: 0, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!