ID: 1139981883_1139981888

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1139981883 1139981888
Species Human (GRCh38) Human (GRCh38)
Location 16:70865818-70865840 16:70865837-70865859
Sequence CCACCAGTGTGGATATTGTCTGG CTGGGTTACCACTTGGTGCATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 101} {0: 2, 1: 0, 2: 0, 3: 9, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!