ID: 1139991271_1139991282

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1139991271 1139991282
Species Human (GRCh38) Human (GRCh38)
Location 16:70941391-70941413 16:70941429-70941451
Sequence CCCGTAATGGCTGTAATTGCAGA CAGTGTGATGGGAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 154} {0: 2, 1: 0, 2: 5, 3: 56, 4: 572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!