ID: 1139991326_1139991333

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1139991326 1139991333
Species Human (GRCh38) Human (GRCh38)
Location 16:70941715-70941737 16:70941730-70941752
Sequence CCGGCTGCCAATGGCCTTCAGCA CTTCAGCAGGCAGAGGAGGGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 186} {0: 2, 1: 1, 2: 63, 3: 1470, 4: 18099}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!