ID: 1139999596_1139999601

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1139999596 1139999601
Species Human (GRCh38) Human (GRCh38)
Location 16:71012298-71012320 16:71012312-71012334
Sequence CCTGCCAGCTTTCTCATTACATG CATTACATGCAGATGTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 193} {0: 2, 1: 1, 2: 0, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!