ID: 1140014042_1140014047

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1140014042 1140014047
Species Human (GRCh38) Human (GRCh38)
Location 16:71164799-71164821 16:71164831-71164853
Sequence CCAAAGGGGGAACCTTTTTCTAG AGGCTCCACAAAGACAGCTAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 119} {0: 2, 1: 0, 2: 0, 3: 16, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!